featSNP

Functional Annotations of SNP

SNP Information

SNP ID: rs71575922

Allele Information:

ChromosomePositionStrandAllele1Allele1 FrequencyAllele2Allele2 Frequency
chr6152554014+C0.936901G0.063099

Referral:
NCBI dbSNPs DATABASEGWAS Catalog

This SNP was reported to be associated with the following human diseases/medical traits:

Please check more details by using the 'NCBI dbSNPs DATABASE' and 'GWAS Catalog' links above.

Genome Sequence
Sequence LocationDNA sequence with Allele1DNA sequence with Allele2
chr6:152554004-152554024ATATCAACTTCTGTGTGGTGCATATCAACTTGTGTGTGGTGC
Transcription Binding Motif Predictions
This SNP doesn't have motif information.
Genes associated with SNP
Gene id/Gene name/Gene typeGene ChromosomeGene StartGene EndGene StrandRelationshipDistance to TSS
ENSG00000131018.18/SYNE1/protein_codingchr6152442819152958936-intron404922
Expression of SNP-associated gene and Predicted binding TFs

SYNE1:

Heatmap

The heatmap can't be displayed probably because:
1. The RPKM of this gene is lower than 0.2.
2. This SNP doesn't have the motif information.

Boxplot and Scatterplot

SYNE1
EpiGenome landscape around SNP
Overlapped Histone ChIP-seq peaks

Active histone modification:

H3K4me3(promoter-associated)    H3K4me1(enhancer-associated)    H3K9ac(promoter-associated)    
H3K27ac(enhancer/promoter-associated)    H3K36me3(transcription-associated)

Repressive histone modification:

h3k27me3    H3K9me3

eQTL
This SNP doesn't have eQTL information or all the p-values of its eQTL data are smaller than 1e-5.